Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3862079
End position: 3862105
Length: 27

DNA sequence
>NC_008595, from 3862079 to 3862105 (27 bp); Mycobacterium avium 104 CGTCCTCGCCGGCCTCGCCGTCCTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3861976-3862533	Sequence	MAV_3732 frr ribosome recycling factor (Protein is coded in complementary strand; from 3862533 to 3861976)