Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3677320
End position: 3677346
Length: 27

DNA sequence
>NC_008595, from 3677320 to 3677346 (27 bp); Mycobacterium avium 104 GCGCGGCCAGCGGGGCCAGCGCGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3677190-3678467	Sequence	MAV_3540 - amidohydrolase (Protein is coded in complementary strand; from 3678467 to 3677190)