Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3425944
End position: 3425970
Length: 27

DNA sequence
>NC_008595, from 3425944 to 3425970 (27 bp); Mycobacterium avium 104 CCGGGTGGACCGGGTGGACCGGGTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3425711-3426085	Sequence	MAV_3281 - hypothetical protein (Protein is coded in complementary strand; from 3426085 to 3425711)