Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 2872548
End position: 2872574
Length: 27

DNA sequence
>NC_008595, from 2872548 to 2872574 (27 bp); Mycobacterium avium 104 GGCGCGGCGGGCTCGGCGGGCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2872212-2874341	Sequence	MAV_2850 - hypothetical protein (Protein is coded in complementary strand; from 2874341 to 2872212)