Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 227200
End position: 227226
Length: 27

DNA sequence
>NC_008595, from 227200 to 227226 (27 bp); Mycobacterium avium 104 CGCCGCCAGCACCGCCAGCGGCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 225293-228574	Sequence	MAV_0225 - arabinosyltransferase C (Protein is coded in complementary strand; from 228574 to 225293)