Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1241424
End position: 1241450
Length: 27

DNA sequence
>NC_008595, from 1241424 to 1241450 (27 bp); Mycobacterium avium 104 GCGGGTGCCGCGGGTGCGGCGGGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1241370-1241960	Sequence	MAV_1297 - hypothetical protein (Protein is coded in complementary strand; from 1241960 to 1241370)