Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 765953
End position: 765976
Length: 24

DNA sequence
>NC_008595, from 765953 to 765976 (24 bp); Mycobacterium avium 104 GCGGGCGCGGGTGCCGGCGCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 764576-769555	Sequence	MAV_0800 - phage tail tape measure protein, family protein, core region (Protein is coded in complementary strand; from 769555 to 764576)