Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 591718
End position: 591741
Length: 24

DNA sequence
>NC_008595, from 591718 to 591741 (24 bp); Mycobacterium avium 104 CGGCGGCGTCGGCGGCGTCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 590889-591965	Sequence	MAV_0607 - oxidoreductase, 2-nitropropane dioxygenase (Protein is coded in complementary strand; from 591965 to 590889)