Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 5296874
End position: 5296897
Length: 24

DNA sequence
>NC_008595, from 5296874 to 5296897 (24 bp); Mycobacterium avium 104 GCCGGCGCCGGTGCCGTCGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5296155-5297009	Sequence	MAV_5146 - peroxisomal multifunctional enzyme type 2 (Protein is coded in complementary strand; from 5297009 to 5296155)