Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 5163828
End position: 5163851
Length: 24

DNA sequence
>NC_008595, from 5163828 to 5163851 (24 bp); Mycobacterium avium 104 GTGGTTGAGGTTGGGGTTGTCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5163046-5164611	Sequence	MAV_5013 - mce-family protein mce1c (Protein is coded in complementary strand; from 5164611 to 5163046)