Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 5136057
End position: 5136080
Length: 24

DNA sequence
>NC_008595, from 5136057 to 5136080 (24 bp); Mycobacterium avium 104 CGGCGGGGGCGGCGGCGCCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5135233-5136252	Sequence	MAV_4986 - ErfK/YbiS/YcfS/YnhG family protein (Protein is coded in complementary strand; from 5136252 to 5135233)