Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 5108738
End position: 5108761
Length: 24

DNA sequence
>NC_008595, from 5108738 to 5108761 (24 bp); Mycobacterium avium 104 ACCCCGAGCCCGAACCCGACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5108219-5109754	Sequence	MAV_4964 - hypothetical protein (Protein is coded in complementary strand; from 5109754 to 5108219)