Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 5010331
End position: 5010354
Length: 24

DNA sequence
>NC_008595, from 5010331 to 5010354 (24 bp); Mycobacterium avium 104 CAGCGCCAGCACCACCGCCAGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5010110-5011102	Sequence	MAV_4878 - permease (Protein is coded in complementary strand; from 5011102 to 5010110)