Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4977463
End position: 4977486
Length: 24

DNA sequence
>NC_008595, from 4977463 to 4977486 (24 bp); Mycobacterium avium 104 GGTGGGGGTCGGGGCGGGGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4977155-4978543	Sequence	MAV_4848 - hypothetical protein (Protein is coded in complementary strand; from 4978543 to 4977155)