Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4961251
End position: 4961274
Length: 24

DNA sequence
>NC_008595, from 4961251 to 4961274 (24 bp); Mycobacterium avium 104 GGACCGGCACCGGAACCGGGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4960593-4962527	Sequence	MAV_4827 - hypothetical protein (Protein is coded in complementary strand; from 4962527 to 4960593)