Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4910432
End position: 4910455
Length: 24

DNA sequence
>NC_008595, from 4910432 to 4910455 (24 bp); Mycobacterium avium 104 CCGCCGTCGCCGCCGCCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4910075-4911214	Sequence	MAV_4787 - hypothetical protein (Protein is coded in complementary strand; from 4911214 to 4910075)