Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4866013
End position: 4866036
Length: 24

DNA sequence
>NC_008595, from 4866013 to 4866036 (24 bp); Mycobacterium avium 104 GGGCGGCGGCGGGGGAGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4865714-4866046	Sequence	MAV_4740 - hypothetical protein (Protein is coded in complementary strand; from 4866046 to 4865714)