Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4846068
End position: 4846091
Length: 24

DNA sequence
>NC_008595, from 4846068 to 4846091 (24 bp); Mycobacterium avium 104 CGGCGACGGCGCGGGCGACGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4845950-4846516	Sequence	MAV_4715 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 4846516 to 4845950)