Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4817502
End position: 4817525
Length: 24

DNA sequence
>NC_008595, from 4817502 to 4817525 (24 bp); Mycobacterium avium 104 GTCGTCGTCCTCGGCGTCATCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4817074-4817637	Sequence	MAV_4688 - hypothetical protein (Protein is coded in complementary strand; from 4817637 to 4817074)