Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4745505
End position: 4745528
Length: 24

DNA sequence
>NC_008595, from 4745505 to 4745528 (24 bp); Mycobacterium avium 104 GGCGGTCGCGGTGGCGGCGGCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4744673-4745545	Sequence	MAV_4611 menA 1,4-dihydroxy-2-naphthoate octaprenyltransferase