Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4306169
End position: 4306192
Length: 24

DNA sequence
>NC_008595, from 4306169 to 4306192 (24 bp); Mycobacterium avium 104 GTCGTCGCCGTCGTCGGCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4305204-4306469	Sequence	MAV_4176 - metallo-beta-lactamase (Protein is coded in complementary strand; from 4306469 to 4305204)