Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4296083
End position: 4296106
Length: 24

DNA sequence
>NC_008595, from 4296083 to 4296106 (24 bp); Mycobacterium avium 104 CACCACCAGCACCACCGCCACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4295751-4296182	Sequence	MAV_4164 - hypothetical protein (Protein is coded in complementary strand; from 4296182 to 4295751)