Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 4041276
End position: 4041299
Length: 24

DNA sequence
>NC_008595, from 4041276 to 4041299 (24 bp); Mycobacterium avium 104 TGAGGCTATGAGCCTATGAGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4040239-4041279	Sequence	MAV_3911 - NADP-dependent alcohol dehydrogenase c
ORF... 4041290-4041703	Sequence	MAV_3912 - hypothetical protein (Protein is coded in complementary strand; from 4041703 to 4041290)