Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3915456
End position: 3915479
Length: 24

DNA sequence
>NC_008595, from 3915456 to 3915479 (24 bp); Mycobacterium avium 104 GCGGCGGCGGGGTCGGCGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3914463-3916172	Sequence	MAV_3788 - acetolactate synthase catalytic subunit (Protein is coded in complementary strand; from 3916172 to 3914463)