Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 381834
End position: 381857
Length: 24

DNA sequence
>NC_008595, from 381834 to 381857 (24 bp); Mycobacterium avium 104 CGCAGCCGCAGTCGCTGCCGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 381231-381938	Sequence	MAV_0389 - CobB/CobQ-like glutamine amidotransferase (Protein is coded in complementary strand; from 381938 to 381231)