Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3667536
End position: 3667559
Length: 24

DNA sequence
>NC_008595, from 3667536 to 3667559 (24 bp); Mycobacterium avium 104 GCGGCGGTGGCGGCGGCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3667512-3667805	Sequence	MAV_3525 - hypothetical protein (Protein is coded in complementary strand; from 3667805 to 3667512)