Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3601524
End position: 3601547
Length: 24

DNA sequence
>NC_008595, from 3601524 to 3601547 (24 bp); Mycobacterium avium 104 CCACCGCCAGCGACACCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3601067-3602095	Sequence	MAV_3456 - radical SAM domain-containing protein (Protein is coded in complementary strand; from 3602095 to 3601067)