Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3563334
End position: 3563357
Length: 24

DNA sequence
>NC_008595, from 3563334 to 3563357 (24 bp); Mycobacterium avium 104 CAGCTGCCGCTGCAGCCGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3563131-3564738	Sequence	MAV_3418 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 3564738 to 3563131)