Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3432989
End position: 3433012
Length: 24

DNA sequence
>NC_008595, from 3432989 to 3433012 (24 bp); Mycobacterium avium 104 GCACCACCACCAGCAGCAGCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3432748-3433185	Sequence	MAV_3291 - nodulation efficiency protein D (NfeD) (Protein is coded in complementary strand; from 3433185 to 3432748)