Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3379283
End position: 3379306
Length: 24

DNA sequence
>NC_008595, from 3379283 to 3379306 (24 bp); Mycobacterium avium 104 GCCGCCGCCGCAGCCACCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3372671-3382918	Sequence	MAV_3244 - linear gramicidin synthetase subunit D (Protein is coded in complementary strand; from 3382918 to 3372671)