Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3341067
End position: 3341090
Length: 24

DNA sequence
>NC_008595, from 3341067 to 3341090 (24 bp); Mycobacterium avium 104 GTTGCCGTAGCCGTTGCCGTAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3340393-3359031	Sequence	MAV_3239 - syringomycin synthetase (Protein is coded in complementary strand; from 3359031 to 3340393)