Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3113608
End position: 3113631
Length: 24

DNA sequence
>NC_008595, from 3113608 to 3113631 (24 bp); Mycobacterium avium 104 GCCGACGCCGACGCCGTCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3093635-3124900	Sequence	MAV_3056 - linear gramicidin synthetase subunit D (Protein is coded in complementary strand; from 3124900 to 3093635)