Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 3040534
End position: 3040557
Length: 24

DNA sequence
>NC_008595, from 3040534 to 3040557 (24 bp); Mycobacterium avium 104 CGGCGGGCCGGTGGGCCGGCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3040361-3040762	Sequence	MAV_3003 - acyl dehydratase (Protein is coded in complementary strand; from 3040762 to 3040361)