Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 2810040
End position: 2810063
Length: 24

DNA sequence
>NC_008595, from 2810040 to 2810063 (24 bp); Mycobacterium avium 104 CGCCGCCGCCGGGGCCGCCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2809850-2810230	Sequence	MAV_2780 - hypothetical protein (Protein is coded in complementary strand; from 2810230 to 2809850)