Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1844776
End position: 1844799
Length: 24

DNA sequence
>NC_008595, from 1844776 to 1844799 (24 bp); Mycobacterium avium 104 CGACGTCGACCTCGACTTCCACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1844550-1845938	Sequence	MAV_1847 - acyltransferase, ws/dgat/mgat subfamily protein