Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1721752
End position: 1721775
Length: 24

DNA sequence
>NC_008595, from 1721752 to 1721775 (24 bp); Mycobacterium avium 104 CCCGCCCGCGCCGCCGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1721029-1721880	Sequence	MAV_1743 - kinase, pfkB family protein (Protein is coded in complementary strand; from 1721880 to 1721029)