Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1675407
End position: 1675430
Length: 24

DNA sequence
>NC_008595, from 1675407 to 1675430 (24 bp); Mycobacterium avium 104 GCGGTGGCGGTGGTGGTGACGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1674723-1675733	Sequence	MAV_1699 - hypothetical protein (Protein is coded in complementary strand; from 1675733 to 1674723)