Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1597735
End position: 1597758
Length: 24

DNA sequence
>NC_008595, from 1597735 to 1597758 (24 bp); Mycobacterium avium 104 CCCGCGGCCGCGCCAGCGCCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1597719-1598540	Sequence	MAV_1634 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 1598540 to 1597719)