Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1244449
End position: 1244472
Length: 24

DNA sequence
>NC_008595, from 1244449 to 1244472 (24 bp); Mycobacterium avium 104 CTCCGCCTCGGCCTGCGCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1243997-1244770	Sequence	MAV_1300 - hypothetical protein (Protein is coded in complementary strand; from 1244770 to 1243997)