Sequence retrieval

Genome: Mycobacterium avium 104
Start position: 1068669
End position: 1068692
Length: 24

DNA sequence
>NC_008595, from 1068669 to 1068692 (24 bp); Mycobacterium avium 104 GCGGCGGCGTCGCCGGCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1068321-1069493	Sequence	MAV_1130 - dehydrogenase (Protein is coded in complementary strand; from 1069493 to 1068321)