Sequence retrieval

Genome: Acidothermus cellulolyticus 11B
Start position: 1602005
End position: 1602072
Length: 68

DNA sequence
>NC_008578, from 1602005 to 1602072 (68 bp); Acidothermus cellulolyticus 11B GCGGCCGTGGAATACGAGCGGCCGTGGAATACGAGCGGCCGTGGAATACGAGCGGCCGTGGAATACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1601633-1602115	Sequence	Acel_1432 - hypothetical protein (Protein is coded in complementary strand; from 1602115 to 1601633)