Sequence retrieval

Genome: Acidothermus cellulolyticus 11B
Start position: 1351842
End position: 1351895
Length: 54

DNA sequence
>NC_008578, from 1351842 to 1351895 (54 bp); Acidothermus cellulolyticus 11B CGCCGGGGTTGGCCGGCTCGCCGGGGCTGGCCGGCTCGCCGGGGCTGGCCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1351896-1352240	Sequence	Acel_1212 - hypothetical protein (Protein is coded in complementary strand; from 1352240 to 1351896)