Sequence retrieval

Genome: Acidothermus cellulolyticus 11B
Start position: 1995993
End position: 1996040
Length: 48

DNA sequence
>NC_008578, from 1995993 to 1996040 (48 bp); Acidothermus cellulolyticus 11B TCCCCGGCCGAAGCCCCGGCCGAAGCCCCGGCCGAAGCCCCGGCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1995849-1996817	Sequence	Acel_1761 - sigma 54 modulation protein/ribosomal protein S30EA (Protein is coded in complementary strand; from 1996817 to 1995849)