Sequence retrieval

Genome: Acidothermus cellulolyticus 11B
Start position: 1630174
End position: 1630221
Length: 48

DNA sequence
>NC_008578, from 1630174 to 1630221 (48 bp); Acidothermus cellulolyticus 11B GCGACGGAGACGGCGACGGAGACAGGGACGGAGACGGGGACGGAGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1629666-1631048	Sequence	Acel_1458 - glycosyl hydrolase family chitinase (Protein is coded in complementary strand; from 1631048 to 1629666)