Sequence retrieval

Genome: Acidothermus cellulolyticus 11B
Start position: 1632572
End position: 1632607
Length: 36

DNA sequence
>NC_008578, from 1632572 to 1632607 (36 bp); Acidothermus cellulolyticus 11B CGGCGACGGAGACGGCGACGGAGACGGGGACGGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1632120-1634411	Sequence	Acel_1460 - glycosyl hydrolase family chitinase (Protein is coded in complementary strand; from 1634411 to 1632120)