Sequence retrieval

Genome: Acidothermus cellulolyticus 11B
Start position: 1788280
End position: 1788306
Length: 27

DNA sequence
>NC_008578, from 1788280 to 1788306 (27 bp); Acidothermus cellulolyticus 11B TGCCGCCTTTGCCGCCTTTGCCGCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1788134-1788625	Sequence	Acel_1589 - histone family protein DNA-binding protein (Protein is coded in complementary strand; from 1788625 to 1788134)