Sequence retrieval

Genome: Acidothermus cellulolyticus 11B
Start position: 1913329
End position: 1913352
Length: 24

DNA sequence
>NC_008578, from 1913329 to 1913352 (24 bp); Acidothermus cellulolyticus 11B CTCGGGCTCGGGCTCGGGCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1912657-1916070	Sequence	Acel_1701 - glycoside hydrolase family protein (Protein is coded in complementary strand; from 1916070 to 1912657)