Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 933075
End position: 933098
Length: 24

DNA sequence
>NC_008576, from 933075 to 933098 (24 bp); Magnetococcus sp. MC-1 CAGCACCAGTACCAGCATCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 932218-933345	Sequence	Mmc1_0754 - cell division protein FtsW (Protein is coded in complementary strand; from 933345 to 932218)