Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 902697
End position: 902741
Length: 45

DNA sequence
>NC_008576, from 902697 to 902741 (45 bp); Magnetococcus sp. MC-1 AGGGGCACCAGCAGCAGGGGCACCAGCAGCAGGGGCACCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 901909-904569	Sequence	Mmc1_0732 - ABC transporter (Protein is coded in complementary strand; from 904569 to 901909)