Sequence retrieval

Genome: Magnetococcus sp. MC-1
Start position: 569753
End position: 569797
Length: 45

DNA sequence
>NC_008576, from 569753 to 569797 (45 bp); Magnetococcus sp. MC-1 GGCTCCACGGGCTTGGGTGCCACGGGCTTGGGCTCGGGGGGCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 568982-569989	Sequence	Mmc1_0469 - TonB family protein (Protein is coded in complementary strand; from 569989 to 568982)